Pilbara Flattie
Karaops
FP-11733
Discoverer: E.S. Volschenk (2024)
Fauna Portal species: 11733Diagnosis
Karaops FP-11733 is only known from juveniles and has been diagnosed with molecular methods (DNA barcoding).
The distribution of this molecular species is split into a western (S of Pannawonica) and eastern (Mindy South) population (see map below). This might be an analytical artefact and these may represent two different species.
Status
- native
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
GATCTGCTATGGTGGGGACAGCTATAAGAGTTTTGATTCGAATGGAGCTGGGACAGACTGGGAGATTTTTAGGAGATGATCATATATATAATGTTATTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATGTGTATACCTATTTTGATTGGGGGATTTGGGAATTGATTAATTCCGTTGATGTTAGGGGCTCCGGATATGGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTACTTTCGCCTTCTTTGATATTATTATTTATTTCATCAATGGTAGAAATAGGGGTTGGAGCTGGGTGAACAGTGTATCCTCCTTTAGCAAGAGTTATAGGGCATGCTGGAAGTGCTGTTGATTTTGCTATTTTTTCTTTACACTTAGCTGGTGCTTCTTCTATTATAGGAAAGTAAATTTTATTTCTACTGTAATTAATATGCGTTCTGTAGGGATATCAATAGAAAAGGTACCTTTATTTGTGTGATCTGAAACTATTACAGCTATTTTGTTATTATTATCATTGCCTGTTTTAGCTGGGGCTATTACTATATTATTGACTGATCGAAATTTTAATACTTCTTTCTAAGATCCTGCTGGGGGAGGGGATCCAATTTTATTTCAACATTTATTGGTC
TAGTTTTTGGAGCTTGATCTGCTATGGTGGGGACAGCTATAAGTGTTTTAATTCGAATGGAATTGGGTCAGACTGGAAGATTTTTAGGAGATGATCATATATATAATGTTATTGTTACTGCGCATGCTTTTGTTATAATTTTTTTTATAGTAATGCCTATTTTGATTGGGGGGTTTGGTAATTGATTAATCCCATTAATGTTGGGGGCTCCGGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTATTACCTCCTTCTTTAATATTATTGTTTATTTCGTCAATAGTAGAAATAGGAGTTGGTGCGGGATGAACAGTTTATCCTCCTTTAGCAAGAGTTATAGGGCATGCTGGGAGTGCTGTTGATTTTGCAATTTTTTCTTTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACTGTAATTAATATACGTTCTGTAGGCATATCAATGGAAAAGGTACCTTTATTTGTATGATCTGTATTTATTACAGCTATTTTATTATTGTTGTCGTTACCAGTTTTAGCAGGAGCAATTACTATATTGTTGACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCTGGAGGTGGTGATCCGATTTTGTTTCAACATTTATTT
Araneae (Spiders)
- Actinopodidae
- Anamidae
- Araneae fam. indet.
- Araneidae
- Archaeidae
- Argyronetidae
- Arkyidae
- Barychelidae
- Cheiracanthiidae
- Clubionidae
- Corinnidae
- Cycloctenidae
- Deinopidae
- Desidae
- Dictynidae
- Filistatidae
- Gnaphosidae
- Halonoproctidae
- Hersiliidae
- Idiopidae
- Lamponidae
- Linyphiidae
- Lycosidae
- Mimetidae
- Miturgidae
- Mysmenidae
- Nicodamidae
- Oecobiidae
- Oonopidae
- Oxyopidae
- Philodromidae
- Pholcidae
- Pisauridae
- Prodidomidae
- Salticidae
- Scytodidae
- Segestriidae
- Selenopidae
- Sparassidae
- Symphytognathidae
- Tetrablemmidae
- Tetragnathidae
- Theridiidae
- Thomisidae
- Trachelidae
- Trachycosmidae
- Trochanteriidae
- Uloboridae
- Zodariidae
- Zoropsidae
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda