Enlarged anterior eyes on distinct mount; males with completely coiled tip of median apophysis, females with coiled ducts.
Flat and Spineless Ground Spiders
Trachycosmidae
(after Azevedo et al. 2022): The family Trachycosmidae can be diagnosed by the anterior lateral spinnerets separated by the length of their diameter or more; the presence of two major ampullate gland spigots in males and females; anterior lateral spinnerets with complete distal article and without inflatable area; epigynal field formed by an undivided plate, usually with an atrium where the copulatory openings are located; lens of the anterior lateral eyes are convex, raised from surrounding cuticle (compared to Trochanteriidae, in which lens is flat).
Azevedo et al. (2022) proposed the Trachycosmidae to include genera previously placed in the Trochanteriidae and Gallieniellidae (Boolathana, Desognanops, Desognaphosa, Fissarena, Hemicloeina, Longrita, Meedo, Morebilus, Neato, Olin, Oreo, Peeto, Platorish, Pyrnus, Questo, Rebilus, Tinytrema, Trachycosmus, Trachyspina, and TrachytremaI), but qualify this by the following statement: A group of Australian genera formerly placed in Gallieniellidae (Meedo, Neato, Oreo, Peeto, and Questo) may deserve family status, since they seem morphologically distinct from other trachycosmids.
Boolathana
2 species
Fissarena
6 species
Retrolateral tibial apophysis of male pedipalp enormously elongated, extending almost to the tip of the palpal cymbium. Females with concomitant elongation of the epigynum, with an anterior hood situated just behind the pedicel, and separated from the remainder of the epigynum by easily extensible cuticle.
Longrita
1 species
Total absence of leg spines; tarsi (especially those of leg IV) distinctively thick and cylindrical.
Meedo
3 species
Differs from Rebilus by the inclined lip at the anterior edge of the sternum, which is accompanied laterally by a pair of greatly enlarged intercoxal sclerites.
Morebilus
1 species
Oreo
1 species
Differ from members of Rebilus and Morebilus in having teeth on the tarsal proclaws.
Pyrnus
1 species
Small, extremely flat with leg coxae separated by sclerotized extensions of the epimeric sclerite.
Tinytrema
1 species
This group includes all trachycosmid species that can currently not be referred to a genus.
Trachycosmidae gen. indet.
1 species
The absence of leg spines readily separates members of this genus from those of Trachytrema and Trachyspina; males have the apex of the cymbium prolonged into a functional conductor.
Trachycosmus
1 species
Similar to Tachytrema, but the body is lighter in color (with a pale gray abdomen), the carapace, abdomen and legs are sparsely covered with short, thick, club setae, the anterior tibiae have leg spines, and all the legs spines are distinctively short
Trachyspina
2 species
Males have a paracymbium (a distinct hook at the basal retrolateral edge of the cymbium), that is absent in Trachycosmus, females have smaller, less squared epigyna and retain some (albeit short and weak) leg spines.
Trachytrema
1 species
Publications
Azevedo GHF, Bougie T, Carboni M, Hedin M, RamÃrez MJ (2022): Combining genomic, phenotypic and Sanger sequencing data to elucidate the phylogeny of the two-clawed spiders (Dionycha). Molecular Phylogenetics and Evolution. 166: 107327
CATAAAGATATTGGAACTTTATATTTGATATTTGGAGCTTGATCGGCTATAGTTGGAACAGCTATAAGAATTTTAATTCGTATAGAATTAGGGTGATCTGGTAGATTGTTAGGTGATGATCATTTATATAATGTAATTGTTACTGCACATGCTTTTGTAATAATTTTTTTTATAGTAATACCAATTTTGATTGGAGGTTTTGGAAATTGATTAGTTCCATTAATATTAGGGGCTCCTGATATAGCTTTTCCACGAATAAATAATTTGAGTTTTTGATTATTACCTCCATCATTATTTTTATTATTTATTTCTTCGATAGCTGAGATGGGAGTTGGAGCTGGATGAACTGTTTATCCTCCTTTGGCTTCGGACGTTGGACATCCAGGAAGTGCGATGGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCGTCTTCAATTATAGGTGCTATTAATTTTATCACCACTGTAATTAATATACGATCGATTAGAAT-AACAATGGAGCGGGTTTCATTATTTGTATGGTCAGTATTGATTACTGCTGTTTTATTATTATTGTCTTTACCTGTGTTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTTAATACGTCTTTTTTTGATCCTGCTGGAGGAGGGGATCCTATTTTATTTCAACATTTATTTTGATTTTTTGGTCAC
CATAAAGATATTGGGACTTTATATTTAATATTTGGTGTTTGATCAGCTATAGTAGGAACAGCTATGAGAATTCTTATTCGTATAGAATTAGGATGGTCTGGAAGATTGTTAGGTGATGATCATTTATATAATGTTATTGTTACAGCGCATGCTTTTGTTATGATTTTTTTTATAGTAATACCAATTTTAATTGGTGGTTTTGGTAATTGATTAATTCCGTTGATGTTAGGGGCTCCTGATATGGCTTTTCCACGAATAAATAATTTAAGTTTTTGATTATTACCACCTTCTTTGTTTTTATTGTTTATTTCGTCTATAGCTGAAATAGGTGTAGGGGCAGGTTGAACTGTTTATCCTCCTTTAGCATCGGGAGTTGGCCATCCTGGAAGTGCTATAGATTTTGCTATTTTTTCTTTACATTTAGCCGGAGCATCATCTATTATAGGTGCTATTAATTTTATTACTACTGTAATTAATATACGATCTTTTAGAAT-AAGAATAGAACGAGTTTCATTGTTTGTGTGATCTGTATTAATCACAGCAGTATTATTATTATTATCGTTACCAGTATTAGCTGGTGCTATTACTATATTGTTAACTGATCGTAATTTTAATACATCTTTTTTTGATCCTGCTGGTGGGGGTGATCCTATTTTATTTCAACATTTATTTTGATTTTTTGGTCAC
Araneae (Spiders)
- Actinopodidae
- Anamidae
- Araneae fam. indet.
- Araneidae
- Archaeidae
- Arkyidae
- Barychelidae
- Cheiracanthiidae
- Clubionidae
- Corinnidae
- Deinopidae
- Desidae
- Dictynidae
- Filistatidae
- Gnaphosidae
- Halonoproctidae
- Hersiliidae
- Idiopidae
- Lamponidae
- Linyphiidae
- Lycosidae
- Mimetidae
- Miturgidae
- Mysmenidae
- Nicodamidae
- Oecobiidae
- Oonopidae
- Oxyopidae
- Philodromidae
- Pholcidae
- Pisauridae
- Prodidomidae
- Salticidae
- Scytodidae
- Segestriidae
- Selenopidae
- Sparassidae
- Symphytognathidae
- Tetrablemmidae
- Theridiidae
- Thomisidae
- Trachelidae
- Trachycosmidae
- Trochanteriidae
- Uloboridae
- Zodariidae
- Zoropsidae
All classes
- Arachnida
- Crustacea
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda