Cork-lid Trapdoor Spider
Conothele
FP-11292 (DNA04)
Discoverer: B. Buzatto (2021, COI)
Fauna Portal species: 11292Diagnosis
Conothele FP-11292 is represented by a single juvenile specimen collected in the Pilbara region of Western Australia. It is diagnosed by molecular methods; it is 18.1% divergent based on COI sequence data from its closest relative, Conothele MYG529.
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
ATCGTTGTATTTGGTGTTTGGTGTTTGGGCGGCTATATTAGGGACAGCTATGAGAGTAATTATTCGGACTGAGTTGGGACAGGTAGGAAGAATGTTAGGAGATGATCATCTGTATAATGTGGTAGTTACTGCTCATGCTTTAGTAATGATTTTTTTTATAGTGATACCCATTATAATCGGCGGATTTGGAAATTGACTTCTTCCTTTGATGATAGGGGCACCTGATATGGCTTTTCCCCGTATAAATAATTTGAGATTTTGGTTGCTTCCTCCTTCTTTATTTCTTTTGTTGTTATCTTCTATAACTGATATTGGGGTTGGTGCAGGGTGAACGATTTATCCTCCTTTATCTTCAGGATTAGGCCATGGAGGGGGAGGGGTAGATTTTGCTATTTTTTCTCTCCATTTGGCTGGAGCTTCATCGATTATGGGGTCTATTAATTTTATTTCTACTATTATTAATATGCGATCAGTAGGAATGTCTATGGAGCGGGTTCCTTTATTTATTTGATCTGTTTTAATTACAACTATTTTATTGCTATTATCGTTACCGGTATTGGCTGGAGCTATTACTATGTTGTTGACTGATCGAAACTTTAATACTTCTTTTTTTGATCCCGCTGGAGGGGGAGATCCAGTGTTGTTTCAACACTTATTTT
Araneae (Spiders)
- Actinopodidae
- Anamidae
- Araneae fam. indet.
- Araneidae
- Archaeidae
- Argyronetidae
- Arkyidae
- Barychelidae
- Cheiracanthiidae
- Clubionidae
- Corinnidae
- Cycloctenidae
- Deinopidae
- Desidae
- Dictynidae
- Filistatidae
- Gnaphosidae
- Halonoproctidae
- Hersiliidae
- Idiopidae
- Lamponidae
- Linyphiidae
- Lycosidae
- Mimetidae
- Miturgidae
- Mysmenidae
- Nicodamidae
- Oecobiidae
- Oonopidae
- Oxyopidae
- Philodromidae
- Pholcidae
- Pisauridae
- Prodidomidae
- Salticidae
- Scytodidae
- Segestriidae
- Selenopidae
- Sparassidae
- Symphytognathidae
- Tetrablemmidae
- Tetragnathidae
- Theridiidae
- Thomisidae
- Trachelidae
- Trachycosmidae
- Trochanteriidae
- Uloboridae
- Zodariidae
- Zoropsidae
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
