Open-hole Trapdoor Spider
Kwonkan
FP-11414
Discoverer: Bruno Buzatto (2022)
Fauna Portal species: 11414Diagnosis
Kwonkan FP-11414 is only known from two juvenile specimens and is diagnosed molecularly. I an analysis on Pilbara Kwonkan species, it was at least 13.3% divergent at the COI gene fragment to all other species, with an intraspecific divergence of 0.6%.
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
GGAACTGGAGATAAGAGTTATTATTCGAACCGAATTGGGGCACGTTGGAAGATTGTTGGGTGATGATCATCTTTATAATGTGGTAGTTACTGCTCATGCTTTAGTTATAATTTTTTTTATGGTGATGCCTATTATGATTGGAGGATTTGGGAATTGGTTGGTTCCTTTAATGTTAGGAGCTCCTGATATAGCTTTTCCTCTTATAAATAATTTGAGTTTTTGGTTGTTGCCACCTTCTTTATTTTTGTTGATTTTATCATCTTTAACGGATGTAGGTGTAGGGGCTGGTTGCACCATTTTTCCTCCTCTGTCTTC
GGAACTGGAGATAAGAGTTATTATTCGAACCGAATTGGGGCACGTTGGAAGATTGTTGGGTGATGATCATCTTTATAATGTGGTAGTTACTGCTCATGCTTTAGTTATAATTTTTTTTATGGTGATGCCTATTATGATTGGAGGATTTGGGAATTGGTTGGTTCCTTTAATGTTAGGAGCTCCTGATATAGCTTTTCCTCTTATAAATAATTTGAGTTTTTGGTTGTTGCCACCTTCTTTATTTTTGTTGATTTTATCATCTTTAACGGATGTAGGTGTAGCCGCTGGTTGCACCATTTTTCCTCCTCTGTCTTCGGTTGTGGGTCATGGGGGTGGTGGAATAGATTTTGCTATTTTTTCTTTGCATTTGGCAGGGGCTTCTTCTATTATGGGAGCAATCAATTTTATTACGACTATTGTTTATATGCGTGTAATTGGAATTACATTGGAACGAATTCCTTTATTTGTCTGGTCTGTTTTGGTTACTGCTGTTCTATTATTGCTTTCTCTTCCGGTACTGGCTGGTGCAATTACTATAAAATTT
Araneae (Spiders)
- Actinopodidae
- Anamidae
- Araneae fam. indet.
- Araneidae
- Archaeidae
- Arkyidae
- Barychelidae
- Cheiracanthiidae
- Clubionidae
- Corinnidae
- Deinopidae
- Desidae
- Dictynidae
- Filistatidae
- Gnaphosidae
- Halonoproctidae
- Hersiliidae
- Idiopidae
- Lamponidae
- Linyphiidae
- Lycosidae
- Mimetidae
- Miturgidae
- Mysmenidae
- Nicodamidae
- Oecobiidae
- Oonopidae
- Oxyopidae
- Philodromidae
- Pholcidae
- Pisauridae
- Prodidomidae
- Salticidae
- Scytodidae
- Segestriidae
- Selenopidae
- Sparassidae
- Symphytognathidae
- Tetrablemmidae
- Theridiidae
- Thomisidae
- Trachelidae
- Trachycosmidae
- Trochanteriidae
- Uloboridae
- Zodariidae
- Zoropsidae
All classes
- Arachnida
- Crustacea
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda