Barrow Island Wishbone Spider (WAM MYG593) Aname amabilis Wilson, Rix & Harvey, 2025
Fauna Portal species: 385Diagnosis
(after Wilson et al. 2025): Males of A. amabilis can be distinguished from all mellosa-complex species for which males are known except A. boreoarca, A. eowilsoni, A. eurarca, A. isabelae, A. terminata and A. zephyrarca by the presence of a highly reflexed embolus (projection angle <45°). They can further be distinguished from A. boreoarca, A. eurarca, A. isabelae, A. terminata and A. zephyrarca by the presence of a longer embolus (length ~2.1 × bulb length; cf. <2.0×), and from A. eowilsoni by the presence of a thicker metatarsus I (length <4.1 × width). Females of A. amabilis can be distinguished from A. isabelae, A. jillae, A. nacta, A. prospecta and A. sangeri by the absence of very short, thorn-like setae covering the sternum. Females of A. amabilis cannot be confidently distinguished morphologically from the remaining species of the mellosa-complex from the Pilbara bioregion due to insufficient information on intraspecific variation, however current data suggest that no other species occur on Barrow Island.
Molecular diagnosis (658-bp COI barcode, n = 10): Specimens of A. amabilis can be distinguished from all mellosa-complex species for which data are available by the presence of a C at position 289 and a C at position 514.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Wilson JD, Rix MG, Hillyer MJ, Huey JA, Piccinini A, Redfern GC, Simmons LW, Volschenk ES, Harvey MS (2025): Integrative taxonomy of the hooded wishbone spiders of the Aname mellosa-complex from Western Australia (Araneae: Mygalomorphae: Anamidae). Invertebrate Systematics. 39: 1 - 108DOI
AGAGTTATTATTCGTACTGAGTTAGGACAAGTTGGTAGATTTTTAGGGGATGATCATTTATATAATGTTATTGTTACTGCGCATGCTTTGGTTATGATTTTTTTTATAGTTATACCTATCATAATTGGGGGATTTGGGAATTGGTTGGTGCCTTTGATGTTGGGGGCACCTGATATGGCTTTCCCTCGGATAAATAATTTGAGATTTTGGTTATTACCTCCATCATTATTTTTGCTCATTTTATCTTCAATAACAGAAGTGGGGGTAGGAGCAGGGTGAACTGTTTATCCTCCTTTATCTTCTGTAGTGGGACATAGAGGGGGAGGAATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCTTCTATTATAGGGGCAATTAACTTTATCTCTACTATTGTAAATATGCGATCATTAGGGATGACGATGGAGCGAGTTCCTTTGTTTGTTTGATCCGTTTTAATTACAGCTATTTTATTGTTATTATCCTTGCCTGTGTTAGCGGGGGCTATCACAATATTGTTGACTGATCGAAATTTTAATACTTCATTTTTTGATCCTGCAGGGGGGGGGGATCCTATTTTATTCCAACATTTATTTTGATTTTTTGGT
AGAGTTATTATTCGTACTGAGTTAGGACAAGTTGGTAGATTTTTAGGGGATGATCATTTGTATAATGTTATTGTTACCGCGCATGCTTTGGTTATGATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTTGGCAATTGGTTGGTGCCCTTGATGTTGGGGGCACCTGATATGGCTTTCCCTCGGATAAATAATCTGAGATTTTGGTTGTTACCCCCATCATTATTTTTACTCATTTTATCTTCGATAACAGAAGTGGGGGTAGGAGCAGGGTGAACTGTTTATCCTCCTTTATCTTCTGTAGTGGGACATAGAGGGGGGGGGATGGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCTTCTATTATAGGGGCAATTAACTTTATCTCTACTATTGTAAATATGCGATCATTAGGGATGACGATGGAGCGAGTTCCTTTGTTTGTTTGATCCGTTTTAATTACTGCTATTTTATTGTTATTATCTTTGCCTGTGTTAGCGGGGGCTATTACAATATTGTTGACTGATCGAAATTTTAATACTTCATTTTTTGATCCTGCAGGGGGGGGAGATCCTATTTTATTCNAACATTTATTTTGATTTTTTGGT
GACATTATATTTAATTTTTGGTGTTTGGTCAGCTATAGTGGGGACAGCAATGAGAGTTATTATTCGTACTGAGTTAGGACAAGTTGGTAGATTTTTAGGGGATGATCATTTATATAATGTTATTGTTACCGCGCATGCTTTGGTAATGATTTTTTTTATAGTTATACCTATCATAATTGGGGGATTTGGGAATTGGTTGGTGCCTTTAATGTTGGGGGCACCTGATATGGCTTTCCCTCGGATAAACAATTTGAGATTTTGGTTATTACCTCCATCATTATTTTTGCTCATTTTATCTTCAATAACAGAAGTGGGGGTAGGAGCAGGGTGAACTGTTTATCCTCCTTTATCTTCTGTAGTGGGACATAGAGGGGGGGGGATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCTTCTATTATAGGGGCAATTAATTTTATCTCTACTATTGTAAATATGCGATCATTAGGGATGACGATGGAGCGAGTTCCTTTGTTTGTTTGATCCGTTTTAATTACTGCTATTTTGTTGTTATTATCCTTGCCTGTGTTAGCGGGGGCTATCACAATATTGTTGACTGATCGAAATTTTAATACTTCATTTTTTGATCCTGCGGGGGGGGGAGATCCTATTTTATTCCAACATTTATTT
Araneae (Spiders)
- Actinopodidae
- Anamidae
- Araneae fam. indet.
- Araneidae
- Archaeidae
- Argyronetidae
- Arkyidae
- Barychelidae
- Cheiracanthiidae
- Clubionidae
- Corinnidae
- Cycloctenidae
- Deinopidae
- Desidae
- Dictynidae
- Filistatidae
- Gnaphosidae
- Halonoproctidae
- Hersiliidae
- Idiopidae
- Lamponidae
- Linyphiidae
- Lycosidae
- Mimetidae
- Miturgidae
- Mysmenidae
- Nicodamidae
- Oecobiidae
- Oonopidae
- Oxyopidae
- Philodromidae
- Pholcidae
- Pisauridae
- Prodidomidae
- Salticidae
- Scytodidae
- Segestriidae
- Selenopidae
- Sparassidae
- Symphytognathidae
- Tetrablemmidae
- Tetragnathidae
- Theridiidae
- Thomisidae
- Trachelidae
- Trachycosmidae
- Trochanteriidae
- Uloboridae
- Zodariidae
- Zoropsidae
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
