Mouse Spider Missulena FP-11270 (DNA03)
Fauna Portal species: 11270Diagnosis
Missulena FP-11270 is currently only known from juveniles and cannot be diagnosed morphologically. Genetic analyses of the COI-barcoding gene fragment support it as a new species, at least 11.4% divergent from any other species in the genus for which there are COI sequences available for analyses (>150 sequences). Phylogenetically most closely related (based on COI data) is Missulena FP-11337 (WAM MYG252), currently only known from the Roy Hill mine in the Pilbara.
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Similar Species
Publications
Greenberg M.R., Huey J.A., Framenau V.W. & Harms D. (2021): Three new species of mouse spider (Araneae: Actinopodidae: Missulena Walckenaer, 1805) from Western Australia, including an assessment of intra specific variability in a widespread species from the arid biome. Arthropod Systematics & Phylogeny. 79: 509 - 533
AAATTGATTAGTTCCTTTGATGTTAGGGGCTCCTGATATGGCTTTTCCTCGAATGAATAATTTGAGTTTTTGATTGTTACCTCCTTCTTTGTTTATGCTATTGTTGTCATCTATGACTGGGAGAGGCGTCGGAGCAGGATGAACTATTTATCCTCCTTTGTCTTCGGGGTTGGGGCATAGAGGGGGTGGTATAGACTTTGCTATTTTTTCTTTACATTTGGCTGGGGCTTCATCAATTATGGGGGCTATCAATTTTATTTCTACTATTGTGAATATACGGATGGGTGGAATAACAATGGATAGGGTATCTTTATTTGTTTGGTCTGTATTGATTACTGCTGTTTTATTGTTGTTGTCGTTACCTGTGTTGGCTGGGGCTATTACAATATTGTTAACTGATCGTAATTTTAATACTACGTTTTTTGATCCTACAGGAGGAGGGGATCCTGTTTTGTTTCAGCATTTGTTTT
AAATTGATTAGTTCCTTTGATGTTAGGGGCTCCTGATATAGCTTTTCCTCGAATGAATAATTTGAGTTTTTGATTGTTACCTCCTTCTTTGTTTATGTTATTGTTGTCGTCTATAACTGAGAGAGGTGTGGGGGCAGGATGAACTATTTATCCTCCTTTGTCTTCGGGGCTAGGTCATAGAGGGGGTGGAATAGATTTTGCTATTTTTTCTTTACATTTGGCTGGTGCTTCGTCGATTATGGGGGCTATTAATTTTATTTCTACTATTGTAAATATGCGGATGGAGGGGATAACAATGGATAGGGTATCTTTATTTGTTTGATCTGTATTGATTACTGCTGTTTTGTTGTTGTTATCATTACCTGTATTGGCTGGTGCTATTACGATATTGTTAACTGATCGTAATTTTAATACTACGTTTTTTGATCCTGCGGGGGGGGGAGATCCTGTTTTGTTTCAGCATTTGTTTT
AAATTGATTAGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGTATGAATAATTTGAGTTTTTGATTACTTCCTCCTTCTTTGTTTATGTTGCTATTGTCGTCTATAACTGAGAGAGGAGTGGGGGCAGGGTGAACTATTTATCCTCCTTTGTCTTCAGGGTTGGGGCATAGAGGGGGAGGGATAGATTTTGCTATTTTTTCTTTGCATTTGGCGGGGGCTTCGTCGATTATGGGGGCTATTAATTTTATTTCTACTATTGTAAATATACGGATAGAGGGAATGGCGATGGAGAGGGTCTCTTTATTTGTTTGGTCTGTATTGGTTACTGCTGTTTTGTTGTTGTTGTCGTTACCTGTGTTAGCTGGGGCTATTACGATGTTGTTAGCTGACCGAAATTTTAATACTACGTTTTTTGACCCTGCAGGGGGAGGGGATCCTGTTTTGTTTCAGCATTTATTTT
Araneae (Spiders)
- Actinopodidae
- Anamidae
- Araneae fam. indet.
- Araneidae
- Archaeidae
- Argyronetidae
- Arkyidae
- Barychelidae
- Cheiracanthiidae
- Clubionidae
- Corinnidae
- Cycloctenidae
- Deinopidae
- Desidae
- Dictynidae
- Filistatidae
- Gnaphosidae
- Halonoproctidae
- Hersiliidae
- Idiopidae
- Lamponidae
- Linyphiidae
- Lycosidae
- Mimetidae
- Miturgidae
- Mysmenidae
- Nicodamidae
- Oecobiidae
- Oonopidae
- Oxyopidae
- Philodromidae
- Pholcidae
- Pisauridae
- Prodidomidae
- Salticidae
- Scytodidae
- Segestriidae
- Selenopidae
- Sparassidae
- Symphytognathidae
- Tetrablemmidae
- Tetragnathidae
- Theridiidae
- Thomisidae
- Trachelidae
- Trachycosmidae
- Trochanteriidae
- Uloboridae
- Zodariidae
- Zoropsidae
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda