Idiosoma
(after Rix et al. 2017): Species of Idiosoma can be distinguished from all other Arbanitinae by the presence of a median retrolateral digital process on the male pedipalp, distal to the burr-like retrolateral tibial apophysis (this digital process secondarily reduced to a nubbin in a very few species). Males and females of most (but not all) Idiosoma species possess prominent paired sigilla on the dorsal abdomen (also present in Eucanippe). Males, females and juveniles of this genus can also be identified (on the basis of 45 molecular exemplar specimens; by the unique ‘AA’ (rarely ‘AG’ or ‘GA’) motif at positions 643–644 of nuclear MRPL45, by the unique ‘GCGC’ motif at positions 156–159 of nuclear HAT1, and by the following six nuclear nucleotide substitutions: MRPL45 G (654; rarely homoplastic in Arbanitis); RPF2 G(483); XPNPEP3 T(194); HAT1 C(330); ITS2 C(85); and 28S G (1917; rarely homoplastic in Bungulla).
Publications
Rix MG,Raven RJ, Main BY, Harrison SE, Austin AD, Cooper SJB, Harvey MS (2017): The Australasian spiny trapdoor spiders of the family Idiopidae (Mygalomorphae: Arbanitinae): a relimitation and revision at the generic level. Invertebrate Systematics. 31: 566 - 634
TGGTCAGCTATAGTGCGGGACTGCGATAAGAGTAATTATCCGGACAGAAGTTAGGACAGGTGGGTAAATTGTTAGGGGATGACAATCTATATAATGTACTAGTTACGGCTCACGCTTTGGTTATAGATCTTTTTATATAATGATACCTATTATGATCGGAGGATTTTGGAAATGGTTGGTTCCTTTGATATTGGGGGCACCTGATATAGCTTTTCCTCGGATAAATAATTTAAGATTTTGGTTGTTGCCGCCTTCTTTATTTTTTTTTTATGATTTCTTCATTATTGGAGATTGGGGTTGGGGCAGGATGAACTATTTATCCCCCTTTGTCTTCGGGAGTGGGTCATAGAGGAGGTGGAATAGATTTTGTTGTTTTTCTTTACATTTGGAGGCTGTTTCTTCTATCATGGGTGCTATTAATTTTATTTCTACTATTATTAATATGCGAGCTTTAGGCATGTCATTCGAGCGTGTCCCATTGTTTGTTTGGTCTATGATGATTACTGCAATTTTATTGTTGTTGTCTCTTCCGGTGTTGGCTGGTGCTATTACTATATTATTGACGGATCGTAATTTTAATACTGCTTTTTTTGATCCGGCTGGAGGAGGTGATCCTGTTTTATTTCAACACCTATTTTGATTTTTTGGTCACCCTGAAATTTAA
Araneae (Spiders)
- Actinopodidae
- Anamidae
- Araneae fam. indet.
- Araneidae
- Archaeidae
- Arkyidae
- Barychelidae
- Cheiracanthiidae
- Clubionidae
- Corinnidae
- Deinopidae
- Desidae
- Dictynidae
- Filistatidae
- Gnaphosidae
- Halonoproctidae
- Hersiliidae
- Idiopidae
- Lamponidae
- Linyphiidae
- Lycosidae
- Mimetidae
- Miturgidae
- Mysmenidae
- Nicodamidae
- Oecobiidae
- Oonopidae
- Oxyopidae
- Philodromidae
- Pisauridae
- Prodidomidae
- Salticidae
- Scytodidae
- Segestriidae
- Selenopidae
- Sparassidae
- Symphytognathidae
- Tetrablemmidae
- Theridiidae
- Thomisidae
- Trachelidae
- Trachycosmidae
- Trochanteriidae
- Uloboridae
- Zodariidae
- Zoropsidae
All classes
- Arachnida
- Crustacea
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda