Julianne's Indohya (WAM PSE185) Indohya julianneae Harvey & Burger, 2023
Fauna Portal species: 13751Diagnosis
(after Harvey et al. 2023): Indohya julianneae is an epigean species with two pairs of eyes and 14 setae on the carapace (Fig. 59A), thus resembling I. boltoni, I. cardo and I. karenae. It differs from I. karenae by the less robust chelal hand [hand (without pedicel) 1.54 (♂), 1.54 (♀) longer than broad, vs. 1.39 (♀) in I. karenae], from I. cardo by the less prominent chelal teeth in the basal half of the fixed chelal finger, and from I. boltoni by its smaller size [e.g. chela (with pedicel) less than 0.8 mm, vs. greater than 1.0 mm in I. boltoni]. It also differs from all other Indohya species for which sequence data are available by a synapomorphy in COI mtDNA: at base 436 there is a substitution to G. The single sequenced specimen differs from all other sequenced specimens of Indohya by 13.8–29.9%.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
GAAATTGATTAGTTCCTATAATAATTGGAGCTCCTGATATAGCTTTCCCCCGTATAAATAATTTAAGATTTTGACTCCTCCCACCTTCCCTTTCTTTGATAATTATATCTTCATTATTAGAAGTAGGATGTGGAACAGGATGAACTATCTATCCCCCCTTGGCTGGAACATTCGCACATCCGGGGAATGCTGTTGATATAGTAATTTTTTCTCTTCATTTAGCGGGTATTTCATCTATTTTAGGTGCGGTAAATTTTATCACAACTATTTTTAATATACGAATTTCAGGTTTAAAGTTTAAGTTTATGCCATTGTTTGTATGATCTATTTTAGTTACTACAATCTTACTTTTATTAGCTATTCCTGTTTTAGCAGGGGCTATCACTATGCTTTTAACTGACCGTAATTTTAATACTTCGTTTTTTATTCCTTCAGGGGGGGGAGATCCAATTTTATTTCAACATTTATTT
Pseudoscorpiones (Pseudoscorpions)
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
