Jessica's Indohya (WAM PSE150) Indohya jessicae Harvey & Burger, 2023
Fauna Portal species: 13750Diagnosis
(after Harvey et al. 2023): Indohya jessicae belongs to a group of Indohya species that have 12 setae on the carapace and no eyes. It differs from I. anastomosa, I. aquila and I. humphreysi by the presence of 4 setae on tergite I (only 2 setae in I. anastomosa, I. aquila and I. humphreysi). It differs from I. arnoldstrongi, I. cockingi and I. finitima by having numerous pointed teeth on the fixed chelal finger, and from I. cribbi and I. lynbeazleyae by the partially granulate pedipalpal femur and smooth patella (femur and patella granulate in I. cribbi and I. lynbeazleyae). It differs from I. damocles and I. sagmata by its less narrow pedipalpal segments [e.g. chela (with pedicel) less than 4.5 × longer than broad; femur less than 6.0 × longer than broad, vs. chela (with pedicel) at least 5.0 × longer than broad; femur at least 6.5 × longer than broad], and from I. scanloni by its larger size [e.g. chela (with pedicel) 1.81 (♀) mm, vs. 1.395 (♂), 1.505 (♀) in I. scanloni]. It also differs from all other Indohya species for which sequence data are available by two synapomorphies in COI mtDNA: at base 208 there is a substitution to G; and at base 585 there is a substitution to T. The four sequenced specimens differ from all other sequenced specimens of Indohya by 17.5–25.7%.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
CGTATAAATAATTTAAGTTTTTGATTTTTACCACCTTCTTTTAGATTAATAATTTTATCTACCTCAATGGAAATAGGCTGTGGTACAGGATGAACTATTTATCCCCCCTTAGCTGGGAATTTAGCTCACCCCGGAAGAGGAGTGGATATAGTAATCTTTTCACTACACTTAGCAGGGGCTTCTTCAATTTTAGGGGCAGTAAATTTTATTACTACAATTTTTAATATACGAATATCAAATATAAAATTAAAACAAATACCCTTATTTGTTTGATCTATTTTAGTAACAACTATCCTACTTTTATTAGCGATCCCAGTACTGGCTGGAGCTATTACTATGCTTTTAATAGACCGTAATTTTAATACAAGTTTTTTTGTTCCTTCGGGGGGTGGAGATCCAATTTTATTTCAACACTT
CGTATAAATAATTTAAGTTTTTGATTTTTACCACCTTCTTTTAGATTAATAATTTTATCTACCTCAATGGAAATAGGCTGTGGTACAGGATGAACTATTTATCCCCCCTTAGCTGGGAATTTAGCTCACCCCGGAAGAGGAGTGGATATAGTAATCTTTTCACTACACTTAGCAGGGGCTTCTTCAATTTTAGGGGCAGTAAATTTTATTACTACAATTTTTAATATACGAATATCAAATATAAAATTAAAACAAATACCCTTATTTGTTTGATCTATTTTAGTAACAACTATCTTACTTTTATTGGCGATCCCAGTACTGGCTGGAGCTATTACTATACTTTTAATAGACCGTAATTTTAATACAAGTTTTTTTGTTCCTTCGGGGGGTGGAGACCCAATTTTATTTCAACACTT
AATGATAATTGGGGCTCCAGACATAGCTTTCCCCCGTATAAATAATTTAAGTTTTTGATTTTTACCACCTTCTTTTAGACTAATAATTTTATCTACTTCAATAGAAATAGGCTGTGGTACAGGATGAACTATTTATCCTCCTTTAGCTGGAAATTTAGCCCATCCTGGAAGAGGAGTGGATATGGTAATCTTTTCTTTACACTTAGCAGGTGCTTCTTCAATTTTAGGGGCAGTAAATTTTATTACTACAATTTTTAATATACGAATGTCAAATATAAAGTTAAAACAAATACCTTTATTTGTTTGATCCATTCTAGTAACAACCATTCTACTTTTATTAGCTATTCCAGTATTAGCTGGAGCTATTACTATACTTTTAATAGACCGTAATTTTAATACGAGTTTTTTTGTTCCTTCTGGAGGTGGAGATCCAATTTTATTTCAACACTTATTT
GATATAGCTTTCCCTCGTATAAATAATTTAAGTTTTTGATTTTTACCACCTTCTTTTAGATTAATAATTTTATCTACTTCAATGGAAATGGGCTGTGGTACAGGATGAACTATTTATCCTCCTCTAGCAGGAAATTTAGCCCACCCTGGGAGAGGAGTAGATATAGTAATTTTTTCTTTACATCTAGCAGGGGCTTCTTCAATTTTAGGGGCAGTAAATTTTATTACTACAATTTTTAATATACGAATATCAAATATAAAATTAAAACAAATACCTTTATTTGTTTGATCTATTCTAGTAACAACCATCCTACTTTTATTAGCGATCCCAGTATTGGCAGGAGCTATTACCATACTTTTAATAGACCGTAATTTTAATACTAGTTTTTTTGTTCCTTCCGGGGGTGGAGATCCAATTTTATTTCAACACTTATTT
Pseudoscorpiones (Pseudoscorpions)
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
