Catherine's Indohya Indohya catherineae Harvey & Burger, 2023
Fauna Portal species: 13742Diagnosis
(after Harvey et al. 2023): Indohya catherineae is a blind troglobite that differs from all other Indohya species for which sequence data are available by five synapomorphies in COI mtDNA: at base 305 there is a substitution to G; at base 308 there is a substitution to C; at base 362 there is a substitution to A; at base 368 there is a substitution to G; and at base 369 there is a substitution to T. The single sequenced specimen differs from all other sequenced specimens of Indohya by 15.6–25.8%.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
GGCCAGTGGTCAACAAATCATAAAGATATTGGAACTTTATATTTTTTTTTAGGAATTTGATCAGGTCTTTTAGGAATATCTTATAGTATAATTATCCGTTTACAATTATCCTCTCCTGGAANNNTATTAATTCTTGAACACTCATACAATGTTGTAGTTACAACTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGGGGTTTTGGAAATTGATTGGTTCCAATGATAATTGGAGCTCCTGATATAGCTTTTCCCCGAATAAATAATCTAAGTTTTTGACTTCTTCCCCCATCTTTAAGATTAATAATTTTATCTACATCAGTACAAATAGGATGTGGAACAGGCTGAACTATTTATCCTCCTTTATCAGGAAATTTAACTCATGTAGATAGGGCTGTAGATATGGTAATTTTTTCTCTTCACCTTGCAGGAGTATCATCAATCTTAGGTGCTATTAATTTTATTACTACTATTTTTAATATACGAATAAATGGATTAAAATTTAAACAAATACCTTTATTTGTTTGATCTATTTTAATTACTACTATTTTATTATTATTAGCTATTCCTGTATTAGCCGGGGCTATTACTATGCTTCTTACAGATCGAAATTTTAATACAAGATTTTTTTCTCCTGCTGGAGGAGGAGATCCAATTTTATTTCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTA
GATATAGCTTTTCCCCGAATAAATAATCTAAGTTTTTGACTTCTTCCCCCATCTTTAAGATTAATAATTTTATCTACATCAGTACAAATAGGATGTGGAACAGGCTGAACTATTTATCCTCCTTTATCAGGAAATTTAACTCATGTAGATAGGGCTGTAGATATGGTAATTTTTTCTCTTCACCTTGCAGGAGTATCATCAATCTTAGGTGCTATTAATTTTATTACTACTATTTTTAATATACGAATAAATGGATTAAAATTTAAACAAATACCTTTATTTGTTTGATCTATTTTAATTACTACTATTTTATTATTATTAGCTATTCCTGTATTAGCCGGGGCTATTACTATGCTTCTTACAGATCGAAATTTTAATACAAGATTTTTTTCTCCTGCTGGAGGAGGAGATCCAATTTTATTTCAACATTTATTT
Pseudoscorpiones (Pseudoscorpions)
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
