Related Indohya (WAM PSE197) Indohya finitima Harvey & Burger, 2023
Fauna Portal species: 13747Diagnosis
(after Harvey et al. 2023): Indohya finitima belongs to a group of Indohya species that have 12 setae on the carapace and no eyes. It differs from I. anastomosa, I. aquila and I. humphreysi by the presence of 4 setae on tergite I (only 2 setae in I. anastomosa, I. aquila and I. humphreysi). It differs from all of the others except I. arnoldstrongi by the rounded distal teeth of the fixed chelal finger (at least 2 distal teeth pointed in I. alexanderi, I. cockingi, I. cribbi, I. damocles, I. draconis, I. jessicae, I. lynbeazleyae, I. sagmata and I. scanloni), and differs from I. finitima by at least some of the teeth of the fixed chelal finger being pointed, whereas all teeth are rounded in I. finitima. It also differs from all other Indohya species for which sequence data are available by a synapomorphy in COI mtDNA: at base 59 there is a substitution to G.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
AACATTATATTTATTGTTTGGTATTTGATCAGGAATAATAGGTATAAGATTTAGAATAGTTATTCGTATTCAATTATCTTCTCCCGGTATGCTTATTTCTGAACATATTTATAATGTAGTAGTAACTACTCATGCATTTGTAATAATTTTTTTCATAGTAATACCTCTTATAATTGGAGGATTTGGAAACTGACTAGTACCATTAATAATTGGGGCTCCTGATATAGCTTTTCCTCGAATAAATAATCTTAGATTTTGACTTCTTCCTCCTTCTCTTATATTAATAATTATATCTTCAATATTAGAAGTAGGTTGTGGAACAGGATGAACTGTATATCCTCCCCTAGCAGGAACATTTGCACACCCAGGGAATGCTGTGGACATAGTTATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTGTAAATTTTATTACAACAATTTTTAATATGCGAATTTCAGGTATAAAATTTAAGTTTATACCTTTATTTGTATGATCAATTTTAGTAACTACTATTTTACTTTTATTAGCTATCCCGGTATTAGCAGGAGCAATTACCATACTTCTGACTGATCGTAACTTTAACACTTCATTTTTTATCCCTTCAGGGGGGGGTGATCCAATTTTATTCCAACATTTATTT
Pseudoscorpiones (Pseudoscorpions)
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
