Wall Crab-Spider Karaops FP-11269
Fauna Portal species: 11269Diagnosis
Karaops FP-11269 is at least 5.1% divergent (in the COI barcoding gene) to other species of the genus, specifically the most closely related K. FP-11268 and K. martamarta. The intraspecific COI divergence of Karaops FP-11269 is 4%.
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Similar Species
GACTTTGTATTTAATTTTTGGAGCTTGATCTGCTATGGTGGGGACAGCTATAAGAGTTTTGATTCGAATGGAGTTAGGACAGACTGGGAGATTTTTGGGAGATGATCATATATATAATGTTATTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTGATTGGGGGATTTGGAAATTGATTAATTCCGTTAATATTAGGGGCTCCTGATATGGCTTTTCCTCGTATGAATAATTTAAGTTTTTGATTACTTCCACCTTCTTTAATGTTGTTATTTATTTCATCGATGGTAGAAATAGGGGTCGGAGCTGGTTGAACAGTATATCCTCCTTTAGCAAGAGTTATGGGACATGCTGGGAGTGCTGTTGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACTGTAATTAATATACGTTCTGTAGGGATATCAATGGAAAAGGTACCTTTATTTGTGTGATCTGTTTTTATTACAGCTATTTTGTTATTATTGTCACTGCCTGTTTTAGCTGGAGCTATTACTATGTTATTAACTGATCGAAATTTTAATACTTCTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATTTCAACATTTATTT
GACTTTATATTTAATTTTTGGAGCCTGATCTGCTATGGTGGGGACAGCTATAAGAGTTTTGATTCGAATGGAGTTAGGACAGACTGGGAGATTTTTAGGAGATGATCATATATATAATGTTATTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTGATTGGGGGATTTGGAAATTGATTAATTCCATTAATGTTAGGGGCTCCTGATATGGCTTTTCCTCGTATAAATAATTTAAGCTTTTGATTACTTCCGCCTTCTTTAATGTTGTTATTTATTTCATCGATGGTAGAAATAGGGGTTGGGGCTGGTTGAACAGTGTATCCTCCTTTAGCAAGAGTTATGGGACATGCTGGGAGTGCTGTTGATTTTGCTATTTTTTCTTTACATTTGGCTGGTGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCCACTGTAATTAATATACGTTCTGTAGGAATGTCAATGGAAAAGGTACCTTTGTTTGTGTGATCTGTTTTTATTACAGCTATTTTGTTATTATTATCACTGCCTGTTTTAGCTGGGGCTATTACTATGTTGTTAACTGATCGAAATTTTAATACCTCTTTCTTTGATCCTGCTGGAGGAGGGGATCCAATTTTATTTCAACATTTATTT
Araneae (Spiders)
- Actinopodidae
- Anamidae
- Araneae fam. indet.
- Araneidae
- Archaeidae
- Argyronetidae
- Arkyidae
- Barychelidae
- Cheiracanthiidae
- Clubionidae
- Corinnidae
- Ctenidae
- Cycloctenidae
- Deinopidae
- Desidae
- Dictynidae
- Filistatidae
- Gnaphosidae
- Halonoproctidae
- Hersiliidae
- Idiopidae
- Lamponidae
- Linyphiidae
- Lycosidae
- Mimetidae
- Miturgidae
- Mysmenidae
- Nicodamidae
- Oecobiidae
- Oonopidae
- Oxyopidae
- Paraplectanoididae
- Philodromidae
- Pholcidae
- Phonognathidae
- Pisauridae
- Prodidomidae
- Salticidae
- Scytodidae
- Segestriidae
- Selenopidae
- Sparassidae
- Symphytognathidae
- Tetrablemmidae
- Tetragnathidae
- Theridiidae
- Thomisidae
- Toxopidae
- Trachelidae
- Trachycosmidae
- Trochanteriidae
- Uloboridae
- Zodariidae
- Zoropsidae
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hymenoptera - Formicidae (Ants)
- Hymenoptera excl. Formicidae (bees and wasps)
- Mantodea (Praying Mantises)
- Orthoptera - Caelifera (Grasshoppers)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
