Mouse Spider (previously DNA03) Missulena FP-11270 (WAM MYG993)
Fauna Portal species: 11270Diagnosis
Missulena FP-11270 is currently only known from juveniles and cannot be diagnosed morphologically. Genetic analyses of the COI-barcoding gene fragment support it as a new species, at least 11.4% divergent from any other species in the genus for which there are COI sequences available for analyses (>150 sequences). Phylogenetically most closely related (based on COI data) is Missulena FP-11337 (WAM MYG252), currently only known from the Roy Hill mine in the Pilbara.
Status
- native
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Similar Species
Publications
Greenberg M.R., Huey J.A., Framenau V.W. & Harms D. (2021): Three new species of mouse spider (Araneae: Actinopodidae: Missulena Walckenaer, 1805) from Western Australia, including an assessment of intra specific variability in a widespread species from the arid biome. Arthropod Systematics & Phylogeny. 79: 509 - 533
AAATTGATTAGTTCCTTTGATGTTAGGGGCTCCTGATATGGCTTTTCCTCGAATGAATAATTTGAGTTTTTGATTGTTACCTCCTTCTTTGTTTATGCTATTGTTGTCATCTATGACTGGGAGAGGCGTCGGAGCAGGATGAACTATTTATCCTCCTTTGTCTTCGGGGTTGGGGCATAGAGGGGGTGGTATAGACTTTGCTATTTTTTCTTTACATTTGGCTGGGGCTTCATCAATTATGGGGGCTATCAATTTTATTTCTACTATTGTGAATATACGGATGGGTGGAATAACAATGGATAGGGTATCTTTATTTGTTTGGTCTGTATTGATTACTGCTGTTTTATTGTTGTTGTCGTTACCTGTGTTGGCTGGGGCTATTACAATATTGTTAACTGATCGTAATTTTAATACTACGTTTTTTGATCCTACAGGAGGAGGGGATCCTGTTTTGTTTCAGCATTTGTTTT
AAATTGATTAGTTCCTTTGATGTTAGGGGCTCCTGATATAGCTTTTCCTCGAATGAATAATTTGAGTTTTTGATTGTTACCTCCTTCTTTGTTTATGTTATTGTTGTCGTCTATAACTGAGAGAGGTGTGGGGGCAGGATGAACTATTTATCCTCCTTTGTCTTCGGGGCTAGGTCATAGAGGGGGTGGAATAGATTTTGCTATTTTTTCTTTACATTTGGCTGGTGCTTCGTCGATTATGGGGGCTATTAATTTTATTTCTACTATTGTAAATATGCGGATGGAGGGGATAACAATGGATAGGGTATCTTTATTTGTTTGATCTGTATTGATTACTGCTGTTTTGTTGTTGTTATCATTACCTGTATTGGCTGGTGCTATTACGATATTGTTAACTGATCGTAATTTTAATACTACGTTTTTTGATCCTGCGGGGGGGGGAGATCCTGTTTTGTTTCAGCATTTGTTTT
AAATTGATTAGTTCCTTTGATGTTGGGGGCTCCTGATATGGCTTTTCCTCGTATGAATAATTTGAGTTTTTGATTACTTCCTCCTTCTTTGTTTATGTTGCTATTGTCGTCTATAACTGAGAGAGGAGTGGGGGCAGGGTGAACTATTTATCCTCCTTTGTCTTCAGGGTTGGGGCATAGAGGGGGAGGGATAGATTTTGCTATTTTTTCTTTGCATTTGGCGGGGGCTTCGTCGATTATGGGGGCTATTAATTTTATTTCTACTATTGTAAATATACGGATAGAGGGAATGGCGATGGAGAGGGTCTCTTTATTTGTTTGGTCTGTATTGGTTACTGCTGTTTTGTTGTTGTTGTCGTTACCTGTGTTAGCTGGGGCTATTACGATGTTGTTAGCTGACCGAAATTTTAATACTACGTTTTTTGACCCTGCAGGGGGAGGGGATCCTGTTTTGTTTCAGCATTTATTTT
Araneae (Spiders)
- Actinopodidae
- Missulena
- bradleyi
- davidi
- dipsaca
- durokoppin
- faulderi
- FP-11270 (WAM MYG993)
- FP-11337 (WAM MYG252)
- FP-12574
- FP-13977 (WAM MYG969)
- FP-13978 (WAM MYG931)
- FP-13979 (WAM MYG966)
- FP-13980 (WAM MYG967)
- FP-13981 (WAM MYG968)
- FP-13982 (WAM MYG964)
- FP-13984 (WAM MYG929)
- FP-13986 (WAM MYG940)
- FP-13987 (WAM MYG047)
- FP-13988 (WAM MYG973)
- FP-13989 (WAM MYG972)
- FP-13990 (WAM MYG932)
- FP-13991 (WAM MYG941)
- FP-13992 (WAM MYG928)
- FP-13993 (WAM MYG970)
- FP-13994 (WAM MYG926)
- FP-13995 (WAM MYG635)
- FP-13996 (WAM MYG048)
- FP-13997 (WAM MYG046)
- FP-13998 (WAM MYG995)
- FP-13999 (WAM MYG939)
- FP-14000 (WAM MYG049)
- FP-14002
- FP-14003
- FP-14004 (WAM MYG290)
- FP-14005 (WAM MYG043)
- FP-14006 (WAM MYG930)
- FP-14008 (WAM MYG226)
- FP-14010 (WAM MYG040)
- FP-14011 (WAM MYG994)
- FP-14012 (WAM MYG962)
- FP-14013 (WAM MYG289)
- FP-14647 (WAM MYG051)
- FP-14648 (WAM MYG844)
- FP-14649 (WAM MYG927)
- FP-14651 (WAM MYG933)
- FP-14652 (WAM MYG971)
- FP-14653
- FP-377 (BWI sp. 1)
- gelasinos
- granulosa
- harewoodi
- hoggi
- ignea
- iugum
- langlandsi
- leniae
- mainae
- manningensis
- melissae
- minima
- occatoria
- pinguipes
- pruinosa
- rutraspina
- terra
- torbayensis
- Missulena
- Anamidae
- Araneae fam. indet.
- Araneidae
- Archaeidae
- Argyronetidae
- Arkyidae
- Barychelidae
- Cheiracanthiidae
- Clubionidae
- Corinnidae
- Ctenidae
- Cycloctenidae
- Deinopidae
- Desidae
- Dictynidae
- Filistatidae
- Gnaphosidae
- Halonoproctidae
- Hersiliidae
- Idiopidae
- Lamponidae
- Linyphiidae
- Lycosidae
- Mimetidae
- Miturgidae
- Mysmenidae
- Nicodamidae
- Oecobiidae
- Oonopidae
- Oxyopidae
- Paraplectanoididae
- Philodromidae
- Pholcidae
- Phonognathidae
- Pisauridae
- Prodidomidae
- Salticidae
- Scytodidae
- Segestriidae
- Selenopidae
- Sparassidae
- Symphytognathidae
- Tetrablemmidae
- Tetragnathidae
- Theridiidae
- Thomisidae
- Toxopidae
- Trachelidae
- Trachycosmidae
- Trochanteriidae
- Uloboridae
- Zodariidae
- Zoropsidae
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hymenoptera - Formicidae (Ants)
- Hymenoptera excl. Formicidae (bees and wasps)
- Mantodea (Praying Mantises)
- Orthoptera - Caelifera (Grasshoppers)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
