Typhlops Indohya Indohya typhlops Harvey, 1993
Fauna Portal species: 12117Diagnosis
(after Harvey et al. 2023): Indohya typhlops has 16 setae on the carapace setae and lacks eyes, thus resembling I. currani, I. gollum and I. napierensis. It differs from I. gollum and I. napierensis in being smaller [e.g. chela (with pedicel) 0.77 (♀) mm vs. greater than 1.8 mm in I. gollum and I. napierensis], and from I. currani by its broader chela [chela (with pedicel) 3.21 (♀) × longer than broad vs. 3.98 (♀) × longer than broad in I. currani] and by having more teeth on the fixed chelal finger [41 teeth (♀), vs. 46 teeth (♀). It also differs from all other Indohya species for which sequence data are available by three synapomorphies in COI mtDNA: at base 172 there is a substitution to G; at base 286 there is a substitution to T; and at base 492 there is a substitution to A. The two sequenced specimens differ from all other sequenced specimens of Indohya by 18.8–26.4%.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
TACATTGTATATATTGCTAGGAATTTGATCAGGTATGATAGGAATAAGTTATAGTATAATTATTCGTCTGCAATTATCCTCTCCAGGGGTGTTAATCTCTGAGCATTCTTATAATGTAGTAGTTACTACTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTCTGATGATCGGGGGATTTGGAAATTGATTGACTCCATTAATAATTGGAGCTCCGGATATATCATTCCCTCGAATAAATAATCTAAGATTTTGATTGTTACCCCCTTCTTTGACCCTTATGATACTTTCTATTTCTATAGAAATAGGATGTGGAACAGGATGGACAATCTACCCTCCTTTAGCAGGAAGCTCAGCCCACCCTGGTCATGCTGTTGATATGGTCATTTTTTCTCTACATTTAGCTGGTGCTTCTTCAATCTTGGGGGCTATTAATTTTATTACTACAATTTTTAATATACGAACAGTTGGACTGAAATTTAAAACTATACCTCTATTTGTTTGATCCATTATAATTACAACTATTCTTCTCCTGTTAGCTATCCCAGTATTAGCCGGTGCTATTACTATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTATTCCATCAGGAGGGGGAGATCCTATTTTATTCCAACATTTATTT
TACATTGTATATATTGCTAGGAATTTGATCAGGTATGATAGGAATAAGTTATAGTATAATTATTCGTCTGCAATTATCCTCTCCAGGGGTGTTAATCTCTGAGCATTCTTATAATGTAGTAGTTACTACTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTCTGATGATCGGGGGATTTGGAAATTGATTGACTCCATTAATAATTGGAGCTCCGGATATATCATTCCCTCGAATAAATAATCTAAGATTTTGATTGTTACCCCCTTCTTTGACCCTTATGATACTTTCTATTTCTATAGAAATAGGATGTGGAACAGGATGGACAATCTACCCTCCTTTAGCAGGAAGCTCAGCCCACCCTGGTCATGCTGTTGATATGATCATTTTTTCTCTACATTTAGCTGGTGCTTCTTCAATCTTGGGGGCTATTAATTTTATTACTACAATTTTTAATATACGAACAGTTGGACTGAAATTTAAAACTATACCTCTATTTGTTTGATCCATTATAATTACAACTATTCTTCTCCTGTTAGCTATCCCAGTATTAGCCGGTGCTATTACTATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTATTCCATCAGGAGGGGGAGATCCTATTTTATTCCAACATTTATTT
Pseudoscorpiones (Pseudoscorpions)
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Ephemeroptera (Mayflies)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hymenoptera - Formicidae (Ants)
- Hymenoptera excl. Formicidae (bees and wasps)
- Mantodea (Praying Mantises)
- Orthoptera - Caelifera (Grasshoppers)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
