Curran's Indohya (WAM PSE181) Indohya currani Harvey & Burger, 2023
Fauna Portal species: 13745Diagnosis
(after Harvey et al. 2023): Indohya currani has 16 carapaceal setae and lacks eyes, thus resembling I. gollum, I. napierensis and I. typhlops. It differs from I. gollum and I. napierensis in being smaller [e.g. chela (with pedicel) 0.855 (♀) mm vs. greater than 1.8 mm in I. gollum and I. napierensis], and from I. typhlops by its narrow chela [chela (with pedicel) 3.98 (♀) × longer than broad vs. 3.21 (♀) × longer than broad in I. typhlops] and by having more teeth on the fixed chelal finger [46 teeth (♀), vs. 41 teeth (♀). There are no unique nucleotide substitutions in COI mtDNA that distinguish this species from all other species of Indohya. The single sequenced specimen differs from all other sequenced specimens of Indohya by 17.6–27.3%.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
TACACTATATCTCCTTCTTGGAATCTGATCAGGAATAGCTGGTATAAGTTACAGAATGATCATTCGTCTTCAACTTTCTTCACCTGGTATAATTATTTCTGAACACACTTATAATGTAGTTGTAACTACTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTCTTATAATTGGTGGATTTGGTAATTGATTAGTACCTCTTATAATTGGAGCTCCAGATATAGCCTTCCCTCGAATGAATAATCTAAGATTTTGGCTTCTTCCTCCTTCTTTAAGATTAATAATTATATCTTCTTCCTTAGAAATAGGATGTGGAACAGGCTGAACTATATATCCTCCTTTAGCAGGCAATATTGCTCATCCGGGGAATGCTGTAGATTTAGTAATCTTTTCCTTACATTTAGCAGGGGCATCATCCATTTTAGGTGCTGTAAATTTTATTACCACAATCTTTAATATGCGAGCCCCTGGACTAAAATTTAAAATAGTCCCATTATTTGTTTGATCAATTTTAATTACGACAATTCTTCTATTATTAGCCATTCCTGTTCTAGCAGGGGCAATTACTATGCTTTTAACAGACCGAAATTTTAATACATCATTTTTCGTTCCTTCGGGGGGTGGAGATCCTATTTTATTTCAACATTTATTT
Pseudoscorpiones (Pseudoscorpions)
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hymenoptera - Formicidae (Ants)
- Hymenoptera excl. Formicidae (bees and wasps)
- Mantodea (Praying Mantises)
- Orthoptera - Caelifera (Grasshoppers)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
