Breakdown Cave Indohya (WAM PSE209) Indohya anastomosa Harvey & Burger, 2023
Fauna Portal species: 13735Diagnosis
(after Harvey et al. 2023): Indohya anastomosa belongs to a group of Indohya species that have 12 setae on the carapace and no eyes. It differs from all others except I. aquila and I. humphreysi by the presence of only 2 setae on tergite I. It differs from I. aquila by being larger [e.g. pedipalpal chela (with pedicel) 2.175 mm (♀) in I. anastomosa and 1.120 mm (♂) in I. aquila] and from I. humphreysi by the position of trichobothrium isb which is midway between esb and ist in I. humphreysi and closer to esb than to ist in I. anastomosa. There are no unique nucleotide substitutions in COI mtDNA that distinguish this species from all other species of Indohya. The holotype differs from all other sequenced specimens of Indohya by 10.1–26.0%.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
AACTTTATATCTTCTTTTAGGAGTATGATCAGGAATATTAGGTATAAGATTTAGAATAATCATTCGATTACAAATATCTTCACCAGGGGTAATTATTTCTGAACATTCTTATAATGTTGTAATTACTACTCATGCATTTGTTATAATTTTTTTTATAGTAATACCTTTAATAATTGGAGGATTTGGTAATTGATTAGTACCAATAATAATTGGAGCTCCAGATATAGCATTCCCACGAATAAATAATTTTAGATTCTGGTTATTACCCCCATCATTAAGATTAATAATTATATCTTCTTTAATAGAAATAGGATGTGGAACTGGATGAACTATTTATCCTCCTTTAGCAAATAAATTTGCCCACCCTGGGAGAGCAGTAGATATAGTAATTTTTTCCCTTCATTTAGCTGGAGTATCATCAATCTTAGGTGCTATTAATTTTATTACTACTATTTTTAATATGCGAACCGTAGGGTTAAAATTTAAAATAATACCTTTATTTGTATGATCAATTTTAATTACTACTATTTTACTTTTATTAGCTATTCCAGTATTAGCAGGTGCCATTACTATACTTCTTACTGATCGTAATTTTAATACTTCATTTTTTATTCCTTCTGGGGGAGGAGACCCTATTTTATTCCAACATTTATTT
Pseudoscorpiones (Pseudoscorpions)
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Ephemeroptera (Mayflies)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hymenoptera - Formicidae (Ants)
- Hymenoptera excl. Formicidae (bees and wasps)
- Mantodea (Praying Mantises)
- Orthoptera - Caelifera (Grasshoppers)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
