Tim's Indohya Indohya sachsei Harvey & Burger, 2023
Fauna Portal species: 13846Diagnosis
(after Harvey et al. 2023): Indohya sachsei most closely resembles I. adlardi and I. rixi as all possess 14 setae on the carapace arranged 4: 2: 4: 2: 2, and they lack eyes. It differs from I. adlardi by its smaller size, e.g. chela (with pedicel) 1.22–1.27 (♀) mm (greater than 1.8 mm in I. adlardi). It differs from I. rixi by trichobothrium sb being much closer to st than to b (ratio sb–st/sb–b = 2.63) [sb slightly closer to st than to b (ratio = 1.16) in I. rixi], and is larger, e.g. chela (with pedicel) 1.22–1.27 (♀) mm [1.055 (♂) mm in I. rixi]. It also differs from all other Indohya species for which sequence data are available by a synapomorphy in COI mtDNA: at base 471 there is a substitution to G. The two sequenced specimens differ from all other sequenced specimens of Indohya by 15.3–28.2%.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
AACACTTTACCTACTCTTAGGAATCTGATCAGGTATAATAGGGATAAGATTTAGAATAATTATTCGTATTCAATTATCATCTCCTGGAATACTTATTTCAGAGCATATTTATAATGTAGTAGTTACTACTCATGCCTTTGTAATAATTTTTTTTATAGTTATACCTCTAATAATTGGAGGGTTTGGAAATTGATTAGTACCAATAATAATTGGTGCTCCAGATATAGCTTTCCCTCGTATAAATAATTTAAGTTTTTGATTACTTCCCCCTTCTATATCTTTAATGATTATATCATCTTTGTTAGAAGTGGGATGTGGTACTGGATGAACTATTTATCCTCCTTTAGCAGGAATACTTGCTCATCCTGGTAATGCTGTAGATATAGTAATCTTTTCTTTACACCTAGCTGGAATTTCTTCTATTTTAGGTGCTGTAAATTTTATTACTACTATTTTTAATATACGAAGTTCTGGACTTAAATTTAAGTTTATACCTTTATTTGTATGGTCAATTTTAGTTACTACTATTCTTCTTTTACTGGCTATTCCTGTTTTAGCAGGTGCAATTACCATATTATTAACTGATCGAAATTTTAATACATCATTTTTTATTCCCTCAGGGGGAGGTGATCCTATTTTATTTCAACACCTATTT
AACACTTTACTTACTCTTAGGAATCTGATCAGGTATAATAGGGATAAGATTTAGAATAATTATTCGTATTCAATTATCATCTCCTGGGATACTTATTTCAGAACATATTTATAATGTAGTAGTTACTACTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTCTAATAATTGGGGGGTTTGGAAATTGATTAGTACCAATAATAATTGGTGCTCCAGATATAGCTTTCCCTCGTATAAATAATTTAAGTTTTTGATTACTTCCCCCTTCTATATCTTTAATAATTATATCATCTTTGTTGGAAGTAGGATGTGGTACTGGATGAACTATTTATCCTCCCTTAGCGGGAATATTCGCTCATCCTGGTAATGCTGTAGATATAGTAATCTTTTCTCTACACCTAGCTGGAATTTCTTCTATTTTAGGTGCTGTAAATTTTATTACTACTATTTTTAATATACGAAGTTCTGGACTTAAATTTAAGTTTATACCTTTATTTGTATGGTCAATTTTAGTTACTACTATTCTTCTTTTACTGGCTATTCCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTTAATACATCATTTTTTATTCCCTCAGGGGGAGGTGATCCTATTTTATTTCAACACCTATTT
Pseudoscorpiones (Pseudoscorpions)
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hymenoptera - Formicidae (Ants)
- Hymenoptera excl. Formicidae (bees and wasps)
- Mantodea (Praying Mantises)
- Orthoptera - Caelifera (Grasshoppers)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
