Alexander's Indohya (WAM PSE154) Indohya alexanderi Harvey & Burger, 2023
Fauna Portal species: 13734Diagnosis
(after Harvey et al. 2023): Indohya alexanderi belongs to a group of Indohya species that have 12 setae on the carapace and no eyes. It differs from I. anastomosa, I. aquila and I. humphreysi by the presence of 4 setae on tergite I (only 2 setae in I. anastomosa, I. aquila and I. humphreysi). It differs from I. arnoldstrongi, I. cockingi and I. finitima by having numerous pointed teeth on the fixed chelal finger, and from I. alexanderi, I. cribbi, I. damocles,I. jessicae, I. lynbeazleyae, I. sagmata and I. scanloni by its smaller size [e.g. chela (with pedicel) less than 1.20 mm, vs. at least 1.39 mm in the others] and by the fewer teeth of the fixed chelal finger (49 teeth, vs. 69–85 teeth in the others). It differs from I. draconis by the shape of the chelal hand which is slightly narrowed distally in I. alexanderi and rounded in I. draconis, and the shape of the pedipalpal patella which is more elongate in I. alexanderi than in I. draconis. It also differs from all other Indohya species for which sequence data are available by a synapomorphy in COI mtDNA: at base 89 there is a substitution to T. The three sequenced specimens differ from all other sequenced specimens of Indohya by 14.7–26.4%.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
GATATAGCTTTCCCTCGAATAAATAATCTTAGTTTTTGACTTTTACCCCCATCTTTTAGATTAATGATATTATCTGTATCAATAGAAATAGGATGCGGGACAGGGTGAACGCTTTACCCCCCTCTTGCCAGAAGTTCTGCTCATCCTACTAGTGCAGTAGATTTAGTAATTTTTTCTCTTCATCTTGCTGGTGTATCATCTATTTTAGGTTCTATTAATTTTATTACAACTATTTTCAATATACGAATAAATGGTTTAAAATTAAAACAAACTCCTCTATTTATTTGATCAATTTTAATTACAACTATTTTGCTTTTATTAGCTATCCCAGTATTAGCTGGAGCAATTACTATACTTCTAACTGATCGTAATTTCAATACATCTTTTTTTTCTCCTGTAGGAGGGGGAGATCCTATTTTATTTCAACATTTATTT
TACTTTGTATTTTTTATTAGGAATTTGATCAGGTATCGTAGGTATATCTTATAGAATAATAATTCGTCTTCAACTTACTTCACCAGGTTTATTAATTTCTTCGAATTCATATAATGTTATAATTACAACCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATAATAGTAGGGGGTTTTGGAAATTGATTGATTCCACTAATGATTGGTGCACCAGATATAGCTTTTCCTCGAATAAATAATCTTAGATTTTGACTCTTACCCCCATCTTTTAGATTAATAATATTATCTGTATCAATAGAAATAGGATGCGGAACAGGGTGAACACTTTACCCCCCTCTTGCTAGAAGTTCTGCCCATCCTTCTAGAGCAGTAGATCTGGTAATTTTTTCTCTTCATCTTGCTGGTGTATCATCTATTTTAGGGTCTATTAATTTTATTACAACTATTTTCAATATACGAATAAATGGTTTAAAATTAAAACAAACTCCTCTGTTTATTTGATCAATTTTAATTACAACTATTTTGCTTTTATTAGCTATCCCAGTATTAGCTGGAGCAATTACTATGCTTCTAACTGATCGTAATTTCAATACATCCTTTTTTTCTCCTGTAGGAGGGGGAGATCCTATTTTATTTCAACATTTATTT
ACCAGATATAGCTTTTCCTCGAATAAATAATCTTAGATTTTGACTTTTACCCCCTTCTTTTAGATTAATAATACTGTCTGTATCAATAGAAATAGGATGTGGAACAGGATGAACACTTTATCCTCCCCTTGCTAGAAGCTCTGCTCATCCTACCAGAGCAGTAGATTTGGTAATCTTTTCTCTTCATCTTGCTGGGGTATCATCTATTTTAGGTTCTATCAATTTTATTACAACTATTTTTAATATACGAATAAATGGTTTAAAATTAAAACAAACTCCTTTATTTATTTGATCAATTTTAATCACAACTATTTTGCTTTTATTGGCCATTCCAGTATTAGCCGGGGCAATTACTATACTTTTAACCGATCGTAATTTCAATACATCTTTTTTTTCTCCTGTGGGAGGGGGAGATCCCATTTTATTTCAACATTTATTT
