Packsaddle Indohya (WAM PSE179) Indohya sagmata Harvey & Burger, 2023
Fauna Portal species: 13756Diagnosis
(after Harvey et al. 2023): Indohya sagmata belongs to a group of Indohya species that have 12 setae on the carapace and no eyes. It differs from I. anastomosa, I. aquila and I. humphreysi by the presence of 4 setae on tergite I (only 2 setae in I. anastomosa, I. aquila and I. humphreysi). It differs from I. arnoldstrongi, I. cockingi and I. finitima by having numerous pointed teeth on the fixed chelal finger, and from I. cribbi and I. lynbeazleyae by the smooth femur and patella (femur and patella granulate in I. cribbi and I. lynbeazleyae). It differs from I. damocles by its smaller size [e.g. chela (with pedicel) 1.50–1.66 (♂) mm, vs. 2.22–2.32 (♂), 2.22–2.55 (♀) mm in I. damcoles], and from I. jessicae and I. scanloni by its narrow pedipalpal segments [e.g. chela (with pedicel) at least 5.0 × longer than broad; femur at least 6.5 × longer than broad, vs. chela (with pedicel) less than 4.5 × longer than broad; femur less than 6.0 × longer than broad]. There are no unique nucleotide substitutions in COI mtDNA that distinguish this species from all other species of Indohya. The four sequenced specimens differ from all other sequenced specimens of Indohya by 16.5–29.0%.
Status
- native
Linnean Holotype
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Publications
Harvey MS, Burger MAA, Abrams KM, Finston TL, Huey JA, Perina G (2023): The systematics of the pseudoscorpion genus Indohya (Pseudoscorpiones: Hyidae) in Australia. Zootaxa. 5342: 1 - 119DOI
TACATTGTATTTACTTTTCGGTATTTGAGCTGGGGTTACTGGAATAACATTTAGTATAATCATCCGCCTCCAACTTTCTTCTCCTGCAATACTAATTTCTGAGCATTCCTATAATGTAGTAGTAACTACCCATGCCTTTATTATAATTTTCTTCATAGTTATACCACTAATAATTGGAGGTTTCGGAAATTGACTAGTACCGCTAATAATCGGCTCCCCAGATATAGCCTTCCCCCGTATAAATAATTTAAGATTTTGGCTCCTCCCACCCTCGTTTAGAATGATAATTCTATCTTCTACTATAGAAATAGGGTGCGGGACTGGGTGGACTCTTTATCCGCCTCTCTCTTCTTGTTCTGCTCACCCAGGTACAGCTACAGATATAGTAATTTTTTCTTTACATCTTGCTGGAGCATCTTCAATTTTAGGAGCAATCAATTTTATTACCACCATTTTTAATATACGTACAGCTAGCCTAAAGTTCAAGCAAGTTCCACTTTTTGTATGATCAATCCTAATTACCACTATCCTTCTTTTACTGGCCATCCCAGTTTTAGCGGGGGCTATCACCATACTATTAACTGATCGAAATTTCAATACAAGCTTTTTCTCTCCTTGTGGAGGGGGTGATCCTATTTTATTCCAACATCTGTTT
TACACTGTATTTACTTTTCGGTATTTGAGCTGGGGTTACTGGAATAACATTTAGTATAATCATCCGCCTCCAACTCTCTTCTCCTGCCATATTAATCTCTGAGCATTCCTATAATGTAGTAGTAACTACCCATGCCTTTATTATAATTTTCTTCATAGTTATACCACTAATAATTGGGGGTTTCGGGAATTGATTAGTACCACTAATAATCGGCTCCCCAGACATAGCCTTTCCTCGTATAAATAATTTAAGATTTTGGCTTCTCCCTCCCTCATTTAGAATGATAATTCTATCTTCTACTATAGAAATAGGATGCGGGACTGGATGGACTCTTTATCCGCCTCTCTCTTCATGCTCCGCTCACCCAGGTACAGCTACAGATATAGTAATTTTTTCTTTACATCTTGCTGGAGCATCTTCTATTTTAGGAGCAATTAATTTTATTACCACCATCTTTAACATACGTACAGCTAATCTGAAGTTCAAGCAAGTTCCACTTTTTGTATGATCAATCTTAATTACCACCATCCTTCTTTTACTGGCCATCCCAGTTTTAGCTGGGGCTATCACCATACTACTAACCGATCGAAATTTCAATACAAGTTTTTTCTCTCCTTGCGGAGGGGGTGACCCTATTTTATTTCAACATTTATTT
TTGATTAGTTCCACTAATAATCGGCTCCCCAGACATAGCCTTTCCTCGTATAAATAATTTAAGATTTTGGCTTCTCCCTCCCTCATTTAGAATGATAATTCTATCTTCTACTATAGAAATAGGATGCGGGACTGGATGGACTCTTTATCCGCCTCTCTCTTCATGCTCCGCTCACCCAGGTACAGCTACAGATATAGTAATTTTTTCTTTACATCTTGCTGGAGCATCTTCTATTTTAGGGGCAATTAATTTTATTACCACCATCTTTAACATACGTACAGCTAATCTGAAGTTCAAGCAAGTTCCACTTTTTGTATGATCAATCTTAATTACCACCATCCTTCTTTTACTGGCCATCCCAGTTTTAGCTGGGGCTATCACCATACTACTAACCGATCGAAATTTCAATACAAGTTTTTTCTCTCCTTGCGGAGGGGGTGACCCTATTTTATTTCAACATTTATTT
GGATTTTTGAAATTGATTAGTTCCGCTAATAATCGGCTCCCCAGATATAGCCTTCCCCCGTATAAATAATTTAAGATTTTGGCTCCTTCCACCCTCGTTTAGAATGATAATTCTATCTTCTACTATAGAAATAGGGTGCGGGACTGGGTGGACTCTTTATCCGCCTCTCTCTTCTTGTTCTGCTCACCCAGGTACAGCTACAGATATAGTAATTTTTTCTTTACATCTTGCTGGAGCATCTTCAATTTTAGGAGCAATCAATTTTATTACCACCATTTTTAATATACGTACAGCTAGCCTAAAGTTCAAGCAAGTTCCACTTTTTGTATGATCAATCCTAATTACCACTATCCTTCTTTTACTGGCCATCCCAGTTTTAGCGGGGGCTATCACCATACTATTAACTGATCGAAATTTCAATACAAGCTTTTTCTCTCCTTGTGGAGGGGGTGATCCTATTTTATTCCAACATTTGTTT
