Round-backed Millipede
Austrostrophus
FP-11536
Discoverer: V.W. Framenau (2022)
Fauna Portal species: 11536Diagnosis
Austrophus FP-11536 is only known from two specimens and is diagnosed molecularly. I an analysis on Pilbara Austrostrophus species, it was at least 17% divergent at the COI gene fragment to other species of the genus in the analysis.
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
AACTATATACTTGATTCTTGGTGCTTGAGCTGCCATGATTGGAACAGCACTAAGAATACTAATTCGAGTAGAGTTAGTTCAACCAGGTAGATTAATCGGAGAGGATCAAATTTATAATGTTATTGTTACAGCCCATGCTTTCGGTATAATTTTCTTTGTAGTCATACCTATTATAAATGGAGGTTTCGGAAATTGACTTGTGCCATTGATACTAGGAGCCGCAGATATAGCTTTCCCTCGAATAAACAACATAAGTTTTTGGTTATTCCCACCGGCTTTCCTCCTTTTAATTTCTTCTTCTATTGTAAAAAAAGGTGTTGGAACTGGATGGACCGTTTATCTTCCCTTAGCCTCAAATCTTGCTCATGCTGGTCCTTCTGTAGATT
AACTATATACTTGATTCTTGGTGCTTGAGCTGCCATGATTGGAACAGCACTAAGAATACTAATTCGAGTAGAGTTAGTTCAACCAGGTAGATTAATCGGAGAGGATCAAATTTATAATGTTATTGTTACAGCCCATGCTTTCGGTATAATTTTCTTTGTAGTCATACCTATTATAAATGGAGGTTTCGGAAATTGACTTGTGCCATTGATACTAGGAGCCGCAGATATAGCTTTCCCTCGAATAAACAACATAAGTTTTTGGTTATTCCCACCGGCTTTCCTCCTTTTAATTTCTTCTTCTATTGTAAAAAAAGGTGTTGGAACTGGATGGACCGTTTATCTTCCCTTAGCCTCAAATCTTGCTCATGCTGGTCCTTCTGTAGATT
Spirobolida (Round-backed Millipedes)
All classes
- Arachnida
- Crustacea
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda