Nyidinghu Subterranean Pseudoscorpion
Indolpium
FP-12589
Discoverer: E.S. Volschenk (2023)
Fauna Portal species: 12589Diagnosis
Indolpium FP-12589 is solely diagnosed by its COI barcoding sequence.
Status
- native
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
GGTACTTTATATTTAATGTTTGGTGTTTGATCTGGTATTGTAGGTATGGGGTATAGAATGATTATTCGAATACAACTTTCTGCCCCAGGTAAGGTAATTGAAGAGCACTCCTATAATGTGGTGGTTACTACTCATGCCTTTTTGATAATTTTTTTTATGGTGATACCTATTTTAATTGGGGGTTTTGGTAACTGATTAGTTCCTTTAATAATCGGATCTCCAGATATAGCCTTTCCTCGTCTGAACAACTTAAGCTTTTGACTCCTCCCACCCTCATTTCTATTAATATTATTTTCATCTGCCTTAGAAATGGGGTGTGGTACTGGATGAACAATTTACCCCCCCTTAGCGGGATTTTCAGGACACCCATCAAAAGCCATAGATTTATTAATTTTTTCCCTTCATTTGGCAGGGATTTCATCTATTCTTGGTGCTATTAATTTTATTTCAACAATTATTAATATGAAAACCCCTGGACTTTCTTACGTAGAAATACCCTTATTTGTGTGGGCTGTTTTATTTACTACTATTCTTTTACTATTAGCCATCCCTGTTCTTGCTGGGGCAATTACAATACTTCTGACAGAT
Pseudoscorpiones (Pseudoscorpions)
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Orthoptera - Caelifera (Grasshoppers)
- Hymenoptera excl. Formicidae (bees and wasps)
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hymenoptera - Formicidae (Ants)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda