Ground Spiders
Gnaphosidae
(after Framenau et al. 2014): Ground Spiders can be identified by the greatly enlarged and widened piriform gland spigots on the anterior lateral spinnerets. This microscopic character can hardly be used for the identification of these spiders in the field. However, these spiders generally have cylindrical anterior spinnerets that are separated by at least their diameter and ovoid silvery posterior median eyes. The outer edge of the maxillae, where the pedipalps emerge, are generally noticeably indented.
Recent phylogenetic work on dionychan spiders (Azevedo et al. 2022) resulted in taxonomic rearrangements within the Gnaphosidae. The Ammoxenidae (see Platnick 2002) are synonymous with and were incorporated into the Gnaphosidae, and the subfamily Molycriinae was moved from the Prodidomidae (see Platnick & Baehr 2006) to the Gnaphosidae.
Publications
Azevedo GHF, Bougie T, Carboni M, Hedin M, Ramírez MJ (2022): Combining genomic, phenotypic and Sanger sequencing data to elucidate the phylogeny of the two-clawed spiders (Dionycha). Molecular Phylogenetics and Evolution. 166: 107327
Framenau VW, Baehr BC, Zborowski P (2014): A guide to the spiders of Australia. New Holland Publishers, 1 - 448
Platnick NI (2002): A revision of the Australasian ground spiders of the families Ammoxenidae, Cithaeronidae, Gallieniellidae, and Trochanteriidae (Araneae: Gnaphosoidea). Bulletin of the American Museum of Natural History. 271: 1 - 243
Platnick NI, Baehr BC (2006): A revision of the Australian ground spiders of the family Prodidomidae (Gnaphosoidea). Bulletin of the American Museum of Natural History. 298: 1 - 287
PDF export is only available with an account and the necessary permissions. Please inquire for access.
Register now
TTTTATTTGGTTCTTGAGCTGCTATAGTAGGAACAGCAATAAGTGTATTGATTCGTATAGAATTAGGACAGTCAGGGAGATTATTAGGAGATGATCATTTATATAATGTTATTGTTACTGCTCATGCGTTTATTATAATTTTTTTTATAGTTATACCAATTTTAATTGGTGGGTTCGGAAATTGGTTAGTTCCTTTGATACTAGGGTCTCCTGATATGGCTTTTCCTCGAATAAATAATTTAAGATTTTGATTATTACCACCTTCATTGATTATATTATTTATTTCATCCATAGCTGAAATAGGTGTGGGAGCTGGATGAACTGTTTATCCTCCTCTGTCAAGAAATGTTGGTCATGCTGGGAGAGCTATGGATTTTGCCATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTTTAGGTGCTGTAAATTTTATTTCAACGATTATTAATATACGATTGGTAGGAATAACTATGGAAAAGGTACCTCTTTTTGTTTGATCAGTTTTTATTACTGCTGTATTGTTATTATTGTCATTACCTGTGTTAGCAGGTGCTATTACTATGTTATTGACTGATCGAAATTTTAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTGTATTATTTCAACATTTATTTTGATTTTTTGGTCACCCTGGAAGTTTA