Open-holed Trapdoor Spider Kwonkan FP-11277 (DNA)
Fauna Portal species: 11277Diagnosis
Kwonkan FP-11277 is represented by juveniles only and has been identified based on molecular methods (COI barcoding). Within that analysis, it was most closely related to Kwonkan FP-11339 (WAM MYG327), but also Kwonkan FP-11275.
The species belongs to a group of species with cuspules on the coxae of the fourth leg, previously referred to Yilgarnia.
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
Similar Species
GACTTTATATTTGTTATTTGGGGTTTGGTCGGCTATGATGGGGACTGCTTTAAGAGTTGTGTTGCGAATGGAATTGGGGCGAGTTGGAAGATTGTTGGGGGATGACCATTTATATAATGTTATGGTTACTGCTCATGCCTTGGTTATGATCTTTTTTATAGTGATGCCTATTATGATTGGGGGGTTTGGGAATTGGTTGGTGCCTCTTATGTTGGGGGCACCGGATATAGCTTTCCCTCGGATAAATAATTTGAGTTTTTGGTTGTTGCCGCCTTCTTTATTTATATTGATGATGTCGGCTTTGACTGATGATGGTGTAGGGACTGGATGGACTATTTATCCTCCGTTGTCTTCGGTTGTTGGTCATGGAGGAGGGGGGGTGGATTTTGCTATTTTTTCTTTACATTTGGCTGGAGCTTCTTCAATTATGGGAGCAATTAATTTTATTTCTACTATTATTAATATGCGTATGGTGGGTATGACTATGGAACGTATCCCTTTGTTTGTTTGGTCAGTTTTAATTACTGCTGTGTTATTATTGTTGTCGCTCCCTGTTTTAGCGGGTGCCATTACTATGCTGTTGACTGATCGTAATTTTAATACTTCATTTTTTGACCCGGTTGGAGGGGGGGATCCTATTTTATTTCAGCATTTATTT
