Jump directly to main navigation Jump directly to content
  • Taxonsearch
  • Partner section
  • Contact
Instagram Icon Linkedin Icon Twitter Icon Facebook Icon
Fauna Portal
  • Home
  • Projects
    • All Fauna Portal Species
    • Troglofauna of Western Australia
    • Barrow Island
    • SRE target fauna WA
    • Miyawaki Forests
  • Publications
  • Nucleotide search
  • Area search
  • About
    • Rules
    • Partners
  • News
  • Videos
 
Reset
 
Reset
 
Reset
  1. Home
  2. Projects
  3. Miyawaki Forests
  4. Genus
  • Diplura (Two-pronged Bristletails)
  • Projapygidae
  • Projapygidae gen. indet.
    • Projapygidae gen. indet.image filtersPDF Exportmolecular dataspecies distribution

    Two-pronged Bristletails

    Projapygidae gen. indet.

    Fauna Portal Genus Number: 3669

    This group includes all projapygid diplurans that can currently not be referred to a described genus.

    FP-15207


    Processing

    Loading...

    polygon record search

    Draw polygon on map and press ‘start polygon search’ to limit species to those occurring in polygon

    start polygon search
    reset

    taxon search

    Projapygidae gen. indet. FP-15207

    Fauna Portal Image No. 10965
     

    Processing

    Loading...

    PDF export is only available with an account and the necessary permissions. Please inquire for access.


    Register now
    Download CSV Download FASTA

    Harry Butler Institute
    |
    N39638-2
    |
    1 juv.
    |
    16 June 2026
    |
    Western Australia
    |
    ca. 25 km NW. of Mt Sheila
    |
    COI
    |

    AACTCTTTATTTTATTTTCGGTATGTGATCAGCCATATTAGGGTTAGCCCTAAGACTATTAATTCGTTTAGAACTAAGACAACCAGGAAAATTTATTGGCAATGACCAAACATATAACACAGTAGTAACAGCATACGCATTTATTATAATTTTCTTCATAGTTATACCAATTATAATTGGAGGGTTCGGAAACTGACTCTTACCATTAATACTAGGATCACCAGATATGGCATTCCCGCGACTAAATAACATAAGATTCTGATTATTACCCCCCTCTCTTACGCTTCTACTAATAGGAAGTCTAGTGGAAAGAGGGGCCGGTACAGGATGAACAGTTTACCCTCCCCTAGCCTCAAATATTGCTCACTCTGGGGGAGCAGTAGATTTAACAATTTTCTCCCTTCATTTGGCAGGCGCATCCTCTATCTTAGGGGCAGTCAACTTTATTACTACAGTGATTAATATACGAACAGAAGGAATAAAATTTATTAATGTCCCACTATTCGTCTGATTAATCCTTATTACAGTAATTTTATTATTACTATCATTACCTGTATTAGCTGGAGCAATCACTATACTCCTTACTGATCGAAACCTAAATACTTCATTTTTTGACCCAGCTGGTGGAGGGGACCCAATCCTTTACCAACATCTATT

    Projapygidae gen. indet. FP-15207
    (0 records)
    • 1
    Diplura (Two-pronged Bristletails)
    • Projapygidae
      • Projapygidae gen. indet.
        • FP-15207
    All classes
    • Arachnida
      • Araneae (Spiders)
      • Pseudoscorpiones (Pseudoscorpions)
      • Scorpiones (Scorpions)
    • Crustacea
      • Isopoda (slaters)
    • Entognatha
      • Diplura (Two-pronged Bristletails)
    • Insecta
      • Coleoptera (Beetles)
      • Diptera (flies, mosquitos)
      • Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
      • Hemiptera - Heteroptera (True Bugs)
      • Hymenoptera excl. Formicidae (bees and wasps)
      • Mantodea (Praying Mantises)
      • Trichoptera (Caddisflies)
    • Myriapoda
      • Cephalostigmata (Pseudocentipedes - Symphyla)
      • Lithobiomorpha (Stone Centipedes)
      • Polyzoniida (Sucking Millipedes)

    © 2026 Murdoch University

    • Projects
      • Miyawaki Forests
    • Taxonsearch
    • Partner section
    • Contact