Eastern Pilbara Burrowing Scorpion
Urodacus
FP-14490
Discoverer: V.W. Framenau (2025)
Fauna Portal species: 14490Diagnosis
Urodacus FP-14490 is diagnosed by molecular methods (COI barcoding). Sequence data places it in the U. butleri-complex.
Status
- native
Fauna Portal Reference
Australia
- Western Australia
Fauna Portal Records
The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.
AACTATGTATTTAATATTAGGAGGGTGAGCGTCTATGGTTGGGACAGCTTTGAGATTGATAATTCGTGTTGAGGTAGGGAGTCCTGGCTCTTTTATTGGTGATGATCAGATTTATAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATGCCTATTATAATTGGGGGGTTTGGTAATTGGCTTGTTCCTTTAATGTTGGGGGCTCCTGATATAGCTTTTCCTCGGTTGAATAATATGAGATTTTGATTATTACCTCCTTCTTTTTTTTTATTATTGGGATCTGCTTGTTTAGAGAGAGGGGCTGGAACAGGGTGAACTGTGTATCCTCCTTTATCTTCTAGAATTTTTCATTCTGGAGGTTCTGTTGATATGACTATTTTTTCTTTACATTTGGCTGGAGTTTCTTCTATTTTAGGGGCTATTAATTTTATTACTACAATTTTGAATATGCGAAGAGAGGGGATAGTTTTAGATCGGGTTCCTTTGTTTGTATGATCTGTTAAGATTACTGCAATTTTATTGTTATTGTCTTTACCTGTTTTGGCTGGGGCTATTACTATATTGTTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCAGCAGGAGGGGGGGATCCTATTTTATATCAGCATTTGTTT
All classes
- Arachnida
- Crustacea
- Entognatha
- Gastropoda
- Insecta
- Blattodea s. str. (Cockroaches)
- Coleoptera (Beetles)
- Dermaptera (earwigs)
- Diptera (flies, mosquitos)
- Entomobryomorpha (slender springtails)
- Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
- Hemiptera - Heteroptera (True Bugs)
- Hemiptera - Sternorrhyncha (aphids, scales etc.)
- Hymenoptera - Formicidae (Ants)
- Hymenoptera excl. Formicidae (bees and wasps)
- Mantodea (Praying Mantises)
- Orthoptera - Caelifera (Grasshoppers)
- Trichoptera (Caddisflies)
- Zygentoma (silverfish)
- Myriapoda
