Jump directly to main navigation Jump directly to content
  • Taxonsearch
  • Partner section
  • Contact
Instagram Icon Linkedin Icon Twitter Icon Facebook Icon
Fauna Portal
  • Home
  • Projects
    • All Fauna Portal Species
    • Troglofauna of Western Australia
    • Barrow Island
    • SRE target fauna WA
    • Miyawaki Forests
  • Publications
  • Nucleotide search
  • Area search
  • About
    • Rules
    • Partners
  • News
  • Videos
 
Reset
 
Reset
 
Reset
  1. Home
  2. Projects
  3. All Fauna Portal Species
  4. Species
Species molecular data
  • Geophilomorpha (Soil Centipedes)
  • Geophilidae
  • Sepedonophilus
  • FP-15198

    • Pilbara Soil Centipede Sepedonophilus FP-15198
    Discoverer: A.W. do Prado (2026)

    Fauna Portal species: 15198
    Order: Geophilomorpha (Soil Centipedes)
    Family: Geophilidae


    FP-15198
    Fauna Portal Image No. 15350

    Diagnosis

    Sepedenophilus FP-15198 is currently diagnosed by molecular methods (COI barcoding).

    Status

    • native

    Fauna Portal Reference

    1 juv.
    |
    Harry Butler Institute
    |
    N39360-1
    |
    14 June 2026
    |
    Australia
    |
    Western Australia
    |
    ca. 15 km NNW. of Mt Sheila
    |
    geophile trap

    Australia

    • Western Australia

    Fauna Portal Records

    The map shows all records that have been verified as part of the Fauna Portal project and may not represent the true distribution of a species. Specifically, for described species, check the link to the Atlas of Living Australia on this page for potential wider distributions. Fauna Portal Reference specimens and Linnean types are shown in red. If you identified a specimen that exceeds the distribution of an undescribed species as illustrated here, please contact the Fauna Portal team who can assist with the lodgement of the specimen in a public institution and display on the map.



    Volker Framenau, 08 October 2026
    Download CSV Download FASTA
    Harry Butler Institute
    |
    N39360-1
    |
    1 juv.
    |
    14 June 2026
    |
    Western Australia
    |
    ca. 15 km NNW. of Mt Sheila
    |
    geophile trap
    |
    COI
    |

    GGCTCTTTAATTGGAGATGATCAAATTTATAATGTTATTGTCACAGCTCATGCTTTTGTAATAATTTTCTTTATAGTTATACCTATTATAATGGGTGGATTTGGAAACTGAATGCTTCCCTTAATATTAGGTGCCCCGGATATAGCCTTTCCTCGAATAAATAATTTGAGATTTTGGTTACTGCCTCCTTCTTTAACCCTTTTAATAGCTTCAATAGCTGTAGAAAGAGGAGCTGGAACAGGATGGACAGTTTACCCTCCACTAGCAAGAAATATCTCTCATTCAGGCCCTTCAGTAGACATAACTATTTTTTCCCTTCACTTAGCAGGTGTATCCTCAATCCTAGGCTCTATTAATTTTATTACTACAATTATTAATATACGATCAAGAGGAATAGTTTTAGAGCGCATTCCACTATTCGTATGAAGCGTAAAAATTACGGCAGTTTTACTTCTTCTTTCTCTTCCGGTTCTTGCAGGAGCTATTACAATATTATTAACAGACCGTAACTTGAATACCAGTTTCTTTGAC

    Geophilomorpha (Soil Centipedes)
    • Geophilidae
      • Sepedonophilus
        • FP-12578
        • FP-12579
        • FP-12667
        • FP-13156
        • FP-13157
        • FP-13158
        • FP-13181
        • FP-13182
        • FP-13345
        • FP-13520
        • FP-13521
        • FP-13522
        • FP-13523
        • FP-13524
        • FP-13891 (WAM CHI060)
        • FP-13892
        • FP-14043
        • FP-14267
        • FP-14282
        • FP-14283
        • FP-14284
        • FP-14285
        • FP-14286
        • FP-14287
        • FP-14288
        • FP-14289
        • FP-14290
        • FP-14291 (WAM CHI055)
        • FP-14292
        • FP-14293
        • FP-14294
        • FP-14295
        • FP-14296
        • FP-14386
        • FP-14387
        • FP-14399
        • FP-14523
        • FP-15198
        • FP-15199
        • FP-15200
        • FP-15201
        • FP-15223
        • FP-15224
      • Tuoba
    • Mecistocephalidae
      • Oryidae
        • Schendylidae
          All classes
          • Arachnida
            • Araneae (Spiders)
            • Ixodida (Ticks)
            • Opiliones (Harvestmen)
            • Pseudoscorpiones (Pseudoscorpions)
            • Schizomida (Tail-less Whipscorpions)
            • Scorpiones (Scorpions)
          • Crustacea
            • Amphipoda
            • Isopoda (slaters)
          • Entognatha
            • Diplura (Two-pronged Bristletails)
          • Gastropoda
            • Pulmonata (Land Snails and Slugs)
          • Insecta
            • Blattodea s. str. (Cockroaches)
            • Coleoptera (Beetles)
            • Dermaptera (earwigs)
            • Diptera (flies, mosquitos)
            • Entomobryomorpha (slender springtails)
            • Ephemeroptera (Mayflies)
            • Hemiptera - Auchenorrhyncha (cicadas, planthoppers)
            • Hemiptera - Heteroptera (True Bugs)
            • Hemiptera - Sternorrhyncha (aphids, scales etc.)
            • Hymenoptera - Formicidae (Ants)
            • Hymenoptera excl. Formicidae (bees and wasps)
            • Mantodea (Praying Mantises)
            • Orthoptera - Caelifera (Grasshoppers)
            • Trichoptera (Caddisflies)
            • Zygentoma (silverfish)
          • Myriapoda
            • Cephalostigmata (Pseudocentipedes - Symphyla)
            • Geophilomorpha (Soil Centipedes)
            • Lithobiomorpha (Stone Centipedes)
            • Polydesmida (Keeled Millipedes)
            • Polyzoniida (Sucking Millipedes)
            • Scolopendromorpha (Tropical Centipedes)
            • Spirobolida (Round-backed Millipedes)

          © 2026 Murdoch University

          • Projects
            • All Fauna Portal Species
          • Taxonsearch
          • Partner section
          • Contact